Toll-like receptors (TLRs)

Toll-like receptors (TLRs) are a class of proteins

fallback-image

Deteccion Tuberculosis Por Elisa

Lab Reagents

Elisa Tuberculosis Laboratories manufactures the deteccion tuberculosis por elisa reagents distributed by Genprice. The Deteccion Tuberculosis Por Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact elisa tuberculosis. Other Deteccion products are available in stock. Specificity: Deteccion Category: Tuberculosis Group: Por Elisa

Por Elisa information

POR antibody

10R-5366 100 ul
EUR 691
Description: Mouse monoclonal POR antibody

POR antibody

10R-5367 100 ul
EUR 691
Description: Mouse monoclonal POR antibody

POR antibody

10R-5368 100 ul
EUR 691
Description: Mouse monoclonal POR antibody

POR Antibody

1-CSB-PA06275A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POR. Recognizes POR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

POR ELISA Kit (Human) (OKCD00378)

OKCD00378 96 Wells
EUR 831
Description: Description of target: This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5.UniRule annotation <p>Manual validated information which has been generated by the UniProtKB automatic annotation system.</p> <p><a href="/manual/evidences#ECO:0000255">More…</a></p> Manual assertion according to rulesiHAMAP-Rule:MF_03212 ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

POR ELISA Kit (Rat) (OKCD00903)

OKCD00903 96 Wells
EUR 896
Description: Description of target: This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5.UniRule annotation <p>Manual validated information which has been generated by the UniProtKB automatic annotation system.</p> <p><a href="/manual/evidences#ECO:0000255">More…</a></p> Manual assertion according to rulesiHAMAP-Rule:MF_03212 ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.107 ng/mL

POR ELISA Kit (Rat) (OKCA01907)

OKCA01907 96 Wells
EUR 846
Description: Description of target: This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5.UniRule annotation;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

POR ELISA Kit (Human) (OKEH08257)

OKEH08257 96 Wells
EUR 896
Description: Description of target: This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 38pg/mL

POR ELISA Kit (Mouse) (OKEH08258)

OKEH08258 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 38pg/mL

POR ELISA Kit (Rat) (OKEH08259)

OKEH08259 96 Wells
EUR 896
Description: Description of target: plays a role in electron transport [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098ng/mL

POR Conjugated Antibody

C47179 100ul
EUR 397

POR cloning plasmid

CSB-CL018378HU-10ug 10ug
EUR 682
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2043
  • Sequence: atgatcaacatgggagactcccacgtggacaccagctccaccgtgtccgaggcggtggccgaagaagtatctcttttcagcatgacggacatgattctgttttcgctcatcgtgggtctcctaacctactggttcctcttcagaaagaaaaaagaagaagtccccgagttcacca
  • Show more
Description: A cloning plasmid for the POR gene.

POR Polyclonal Antibody

A57874 100 µg
EUR 570.55
Description: The best epigenetics products

pCMV-SPORT6-POR

PVT14093 2 ug
EUR 391

Anti-POR antibody

STJ110441 100 µl
EUR 413
Description: This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome.

POR Polyclonal Conjugated Antibody

C31450 100ul
EUR 397

Rat POR shRNA Plasmid

20-abx985502
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
October 2021
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031

Categories

Recent Posts

Tags