Lab Reagents

Elisa Tuberculosis Laboratories manufactures the deteccion tuberculosis por elisa reagents distributed by Genprice. The Deteccion Tuberculosis Por Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact elisa tuberculosis. Other Deteccion products are available in stock. Specificity: Deteccion Category: Tuberculosis Group: Por Elisa

Por Elisa information

POR antibody
10R-5366	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal POR antibody

POR antibody
10R-5367	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal POR antibody

POR antibody
10R-5368	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal POR antibody

POR Antibody
1-CSB-PA06275A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POR. Recognizes POR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

POR ELISA Kit (Human) (OKCD00378)
OKCD00378	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5.UniRule annotation <p>Manual validated information which has been generated by the UniProtKB automatic annotation system.</p> <p><a href="/manual/evidences#ECO:0000255">More…</a></p> Manual assertion according to rulesiHAMAP-Rule:MF_03212 ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

POR ELISA Kit (Rat) (OKCD00903)
OKCD00903	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5.UniRule annotation <p>Manual validated information which has been generated by the UniProtKB automatic annotation system.</p> <p><a href="/manual/evidences#ECO:0000255">More…</a></p> Manual assertion according to rulesiHAMAP-Rule:MF_03212 ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.107 ng/mL

POR ELISA Kit (Rat) (OKCA01907)
OKCA01907	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5.UniRule annotation;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

POR ELISA Kit (Human) (OKEH08257)
OKEH08257	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 38pg/mL

POR ELISA Kit (Mouse) (OKEH08258)
OKEH08258	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 38pg/mL

POR ELISA Kit (Rat) (OKEH08259)
OKEH08259	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: plays a role in electron transport [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098ng/mL

POR Conjugated Antibody
C47179	SAB	100ul	EUR 397

POR cloning plasmid
CSB-CL018378HU-10ug	Cusabio	10ug	EUR 682
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2043 Sequence: atgatcaacatgggagactcccacgtggacaccagctccaccgtgtccgaggcggtggccgaagaagtatctcttttcagcatgacggacatgattctgttttcgctcatcgtgggtctcctaacctactggttcctcttcagaaagaaaaaagaagaagtccccgagttcacca Show more
Description: A cloning plasmid for the POR gene.

POR Polyclonal Antibody
A57874	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

pCMV-SPORT6-POR
PVT14093	Lifescience Market	2 ug	EUR 391

Anti-POR antibody
STJ110441	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome.

POR Polyclonal Conjugated Antibody
C31450	SAB	100ul	EUR 397

Rat POR shRNA Plasmid
20-abx985502	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.