Toll-like receptors (TLRs)

Toll-like receptors (TLRs) are a class of proteins

Endosomal Toll-Like Receptors (TLRs) mediate enhancement of IL-17A production triggered by Epstein-Barr virus (EBV) DNA in mice.

Endosomal Toll-Like Receptors (TLRs) mediate enhancement of IL-17A production triggered by Epstein-Barr virus (EBV) DNA in mice.

EBV has long-been associated with autoimmune disorders. We have previously shown that EBV DNA increases the production of IL-17A in mice. These properties may play a role in EBV association with autoimmune diseases. The purpose of this study was to explain the mechanism of EBV DNA in which modulate the levels of IL-17A in mice.To study the potential role of endosomal receptors in the detection of EBV DNA, chloroquine, endosomal maturation inhibitors, used to treat mice peripheral blood mononuclear cells (PBMC) in the presence or absence of EBV DNA. IL-17A levels were then assessed by ELISA.

Furthermore, to determine whether TLR3, 7 or 9 play a role in this pathway, a specific inhibitor used for these TLRs in both the rat PBMC and in vivo in BALB / c mice were treated with viral DNA; the level of IL-17A-17A then equal assessed.IL enhanced production of rat PBMCs cultured with EBV DNA; Pre-incubation of PBMC with chloroquine significantly reduce production.

When the cells were cultured with EBV DNA and TLR3, 7 or 9 inhibitor, a significant reduction in levels of IL-17A is detected. The same reduction in the production of IL-17A-induced EBV DNA in mice was observed when the animals were treated with TLR inhibitors.Endosomal TLRs appear to be involved in recognizing EBV DNA and then trigger the production of IL-17A in mice. The EBV is targeting this receptor positive subjects with delayed investigation of autoimmunity may be useful to assess whether they play the same role in humans.

Endosomal Toll-Like Receptors (TLRs) mediate enhancement of IL-17A production triggered by Epstein-Barr virus (EBV) DNA in mice.
Endosomal Toll-Like Receptors (TLRs) mediate enhancement of IL-17A production triggered by Epstein-Barr virus (EBV) DNA in mice.

MPMBP down-regulates Toll-like receptor (TLR) 2 ligand-induced production of proinflammatory cytokines by inhibiting NF-kB but not AP-1 activation.

MPMBP is a non-nitrogen-containing bisphosphonates new (non-NBP), which has an anti-bone resorptive activity and side chain antioxidants. This study aimed to assess the effect of MPMBP on the production of proinflammatory cytokines and chemokines by macrophage-like cell line, J774.1, in the presence of Toll-like receptor (TLR) agonist.

J774.1 cells were pretreated with or without MPMBP for 5 minutes, then incubated with or without Pam3Cys-Ser- (Lys) 4 (Pam3CSK4, TLR2 agonist) or lipid A (TLR4 agonist) for 24 hours. MPMBP down-regulated TLR2 ligand-induced production of IL-6, MCP-1, MIP-1α and TNF-α, but not TLR4 ligand-induced production of proinflammatory cytokines, and cytotoxic to cells J774.1. Cu-CPT22, TLR2 antagonist, down-regulated Pam3CSK4-induced production of IL-6, MCP-1 and MIP-1α, but not TNF-α. MPMBP inhibiting the translocation of NF-kB p65, but not p50, RelB, or p52 and inhibits the activation of JNK, but not p38 MAPK or ERK, in cells stimulated with Pam3CSK4 J774.1. Additionally, MPMBP not down-regulate AP-1 activation in cells stimulated with Pam3CSK4 J774.1 or lipid A. Our findings suggest that MPMBP inhibits the production of proinflammatory cytokines in cell J774.1 by pressing the activation of NF-kB p65 in TLR2, but not TLR4, track.


blocking the right of pulses like receptor (TLR) activation during development of the disease have been reported to have an inhibitory effect on the pathogenesis of rheumatoid arthritis (RA). We tested whether TLR4 inhibitor TAK-242 has potential as a drug for arthritis arthritis.The therapeutic effect of TAK-242 was tested in vitro using human rheumatoid fibroblast-like synoviocyte (FLS) MH7A lines or primary human FLS and adjuvant-induced arthritis (AIA) rats model.

Bovine Toll Like Receptor 4 (TLR4) ELISA Kit

DLR-TLR4-b-96T 96T
EUR 715
  • Should the Bovine Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Toll Like Receptor 4 (TLR4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Toll Like Receptor 4 (TLR4) ELISA Kit

DLR-TLR4-Hu-48T 48T
EUR 479
  • Should the Human Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Toll Like Receptor 4 (TLR4) ELISA Kit

DLR-TLR4-Hu-96T 96T
EUR 621
  • Should the Human Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Toll Like Receptor 4 (TLR4) ELISA Kit

DLR-TLR4-Mu-48T 48T
EUR 489
  • Should the Mouse Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Toll Like Receptor 4 (TLR4) ELISA Kit

DLR-TLR4-Mu-96T 96T
EUR 635
  • Should the Mouse Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Toll Like Receptor 4 (TLR4) ELISA Kit

DLR-TLR4-Ra-48T 48T
EUR 508
  • Should the Rat Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Toll Like Receptor 4 (TLR4) ELISA Kit

DLR-TLR4-Ra-96T 96T
EUR 661
  • Should the Rat Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Toll Like Receptor 4 (TLR4) ELISA Kit

RDR-TLR4-b-48Tests 48 Tests
EUR 580

Bovine Toll Like Receptor 4 (TLR4) ELISA Kit

RDR-TLR4-b-96Tests 96 Tests
EUR 807

Human Toll Like Receptor 4 (TLR4) ELISA Kit

RDR-TLR4-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 4 (TLR4) ELISA Kit

RDR-TLR4-Hu-96Tests 96 Tests
EUR 692

Mouse Toll Like Receptor 4 (TLR4) ELISA Kit

RDR-TLR4-Mu-48Tests 48 Tests
EUR 511

Mouse Toll Like Receptor 4 (TLR4) ELISA Kit

RDR-TLR4-Mu-96Tests 96 Tests
EUR 709

Rat Toll Like Receptor 4 (TLR4) ELISA Kit

RDR-TLR4-Ra-48Tests 48 Tests
EUR 534

Rat Toll Like Receptor 4 (TLR4) ELISA Kit

RDR-TLR4-Ra-96Tests 96 Tests
EUR 742

Bovine Toll Like Receptor 4 (TLR4) ELISA Kit

RD-TLR4-b-48Tests 48 Tests
EUR 555

Bovine Toll Like Receptor 4 (TLR4) ELISA Kit

RD-TLR4-b-96Tests 96 Tests
EUR 771

Human Toll Like Receptor 4 (TLR4) ELISA Kit

RD-TLR4-Hu-48Tests 48 Tests
EUR 478

Human Toll Like Receptor 4 (TLR4) ELISA Kit

RD-TLR4-Hu-96Tests 96 Tests
EUR 662

Mouse Toll Like Receptor 4 (TLR4) ELISA Kit

RD-TLR4-Mu-48Tests 48 Tests
EUR 489

Mouse Toll Like Receptor 4 (TLR4) ELISA Kit

RD-TLR4-Mu-96Tests 96 Tests
EUR 677

Rat Toll Like Receptor 4 (TLR4) ELISA Kit

RD-TLR4-Ra-48Tests 48 Tests
EUR 511

Rat Toll Like Receptor 4 (TLR4) ELISA Kit

RD-TLR4-Ra-96Tests 96 Tests
EUR 709

CD284 / TLR4(TLR4/230) Antibody

BNUB0230-100 100uL
EUR 209
Description: Primary antibody against CD284 / TLR4(TLR4/230), Concentration: 0.2mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNUB0230-500 500uL
EUR 458
Description: Primary antibody against CD284 / TLR4(TLR4/230), Concentration: 0.2mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNUM0230-50 50uL
EUR 395
Description: Primary antibody against CD284 / TLR4(TLR4/230), 1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC040230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF405S conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC040230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF405S conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC610230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF660R conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC610230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF660R conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC470230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF647 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC470230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF647 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC550230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF555 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC550230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF555 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC050230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF405M conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC050230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF405M conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC400230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF640R conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC400230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF640R conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC430230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF543 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC430230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF543 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC800230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF680 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC800230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF680 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC810230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF680R conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC810230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF680R conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCP0230-250 250uL
EUR 383
Description: Primary antibody against CD284 / TLR4(TLR4/230), PerCP conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCR0230-250 250uL
EUR 383
Description: Primary antibody against CD284 / TLR4(TLR4/230), RPE conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCA0230-250 250uL
EUR 383
Description: Primary antibody against CD284 / TLR4(TLR4/230), APC conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCAP0230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCAP0230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCH0230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCH0230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC940230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF594 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC940230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF594 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC700230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF770 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC700230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF770 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCB0230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), Biotin conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNCB0230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), Biotin conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC880230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF488A conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC880230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF488A conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC680230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF568 conjugate, Concentration: 0.1mg/mL

CD284 / TLR4(TLR4/230) Antibody

BNC680230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF568 conjugate, Concentration: 0.1mg/mL

TLR4 Antibody

24193-100ul 100ul
EUR 390

TLR4 Antibody

24194-100ul 100ul
EUR 390

TLR4 antibody

20R-1503 100 ug
EUR 673
Description: Rabbit polyclonal TLR4 antibody

TLR4 antibody

20R-1505 100 ug
EUR 673
Description: Rabbit polyclonal TLR4 antibody

TLR4 antibody

70R-11717 100 ug
EUR 436
Description: Rabbit polyclonal TLR4 antibody

TLR4 antibody

70R-11719 100 ug
EUR 418
Description: Rabbit polyclonal TLR4 antibody

TLR4 antibody

70R-20849 50 ul
EUR 435
Description: Rabbit polyclonal TLR4 antibody

TLR4 antibody

70R-14023 100 ug
EUR 305
Description: Affinity purified Rabbit polyclonal TLR4 antibody

TLR4 Antibody

35463-100ul 100ul
EUR 390

TLR4 Antibody

35577-100ul 100ul
EUR 252

TLR4 Antibody

3251-100
EUR 338

TLR4 Antibody

3253-100
EUR 327

TLR4 Antibody

3253-30T
EUR 146

TLR4 Antibody

1-CSB-PA001434
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

TLR4 Antibody

1-CSB-PA080181
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

TLR4 Antibody

1-CSB-PA902590
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TLR4 Antibody

1-CSB-PA776633
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

TLR4 Antibody

1-CSB-PA585936
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

TLR4 Antibody

1-CSB-PA237733
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TLR4 antibody

70R-9659 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TLR4 antibody

TLR4 antibody

70R-9688 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TLR4 antibody

TLR4 Antibody

AF7017 200ul
EUR 376
Description: TLR4 antibody detects endogenous levels of total TLR4.

TLR4 Antibody

1-CSB-PA023603GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse, Rat, Bovin. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TLR4 siRNA

20-abx905595
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR4 siRNA

20-abx936895
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR4 siRNA

20-abx936896
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR4 antibody

ABF7017 100 ug
EUR 438

TLR4/CD284

GT15235 100 ug
EUR 526

TLR4 antibody

PAab09837 100 ug
EUR 386

TLR4 Plasmid

PVT7122 2 ug
EUR 266

anti-TLR4

YF-PA24856 50 ul
EUR 334
Description: Mouse polyclonal to TLR4

TLR4 Rabbit pAb

A11226-100ul 100 ul
EUR 308

TLR4 Rabbit pAb

A11226-200ul 200 ul
EUR 459

TLR4 Rabbit pAb

A11226-20ul 20 ul
EUR 183

TLR4 Rabbit pAb

A11226-50ul 50 ul
EUR 223

TLR4 Blocking Peptide

33R-4969 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR4 antibody, catalog no. 70R-9659

TLR4 Blocking Peptide

33R-10686 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR4 antibody, catalog no. 70R-11719

TLR4 Blocking Peptide

3253BP-50
EUR 153

Polyclonal TLR4 Antibody

APG03000G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 . This antibody is tested and proven to work in the following applications:

Polyclonal TLR4 Antibody

APG03001G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 . This antibody is tested and proven to work in the following applications:

TLR4 Rabbit pAb

A0007-100ul 100 ul
EUR 308

TLR4 Rabbit pAb

A0007-200ul 200 ul
EUR 459

TLR4 Rabbit pAb

A0007-20ul 20 ul
EUR 183

TLR4 Rabbit pAb

A0007-50ul 50 ul
EUR 223

TLR4 Polyclonal Antibody

EA180-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR4 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TLR4 Polyclonal Antibody

EA180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR4 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TLR4 Blocking Peptide

AF7017-BP 1mg
EUR 195

TLR4 Conjugated Antibody

C35577 100ul
EUR 397

TLR4 cloning plasmid

CSB-CL023603HU-10ug 10ug
EUR 815
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2520
  • Sequence: atgatgtctgcctcgcgcctggctgggactctgatcccagccatggccttcctctcctgcgtgagaccagaaagctgggagccctgcgtggaggtggttcctaatattacttatcaatgcatggagctgaatttctacaaaatccccgacaacctccccttctcaaccaagaacc
  • Show more
Description: A cloning plasmid for the TLR4 gene.

Polyclonal TLR4 Antibody

AMM05417G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 . This antibody is tested and proven to work in the following applications:

TLR4 Rabbit pAb

A5258-100ul 100 ul
EUR 308

TLR4 Rabbit pAb

A5258-200ul 200 ul
EUR 459

TLR4 Rabbit pAb

A5258-20ul 20 ul
EUR 183

TLR4 Rabbit pAb

A5258-50ul 50 ul
EUR 223

TLR4 Rabbit pAb

A2464-100ul 100 ul
EUR 308

TLR4 Rabbit pAb

A2464-200ul 200 ul
EUR 459

TLR4 Rabbit pAb

A2464-20ul 20 ul Ask for price

TLR4 Rabbit pAb

A2464-50ul 50 ul Ask for price

TLR4 Rabbit pAb

A17436-100ul 100 ul
EUR 308

TLR4 Rabbit pAb

A17436-200ul 200 ul
EUR 459

TLR4 Rabbit pAb

A17436-20ul 20 ul
EUR 183

TLR4 Rabbit pAb

A17436-50ul 50 ul
EUR 223

TLR4 Polyclonal Antibody

ABP57210-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR4 from Human, Mouse, Rat. This TLR4 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR4 Polyclonal Antibody

ABP57210-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR4 from Human, Mouse, Rat. This TLR4 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR4 Polyclonal Antibody

ABP57210-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR4 from Human, Mouse, Rat. This TLR4 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

anti- TLR4 antibody

FNab08727 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: toll-like receptor 4
  • Uniprot ID: O00206
  • Gene ID: 7099
  • Research Area: Neuroscience, Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against TLR4

TLR4 Polyclonal Antibody

ES8209-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR4 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR4 Polyclonal Antibody

ES8209-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR4 from Human/Mouse/Rat. This antibody is tested and validated for IHC

anti- TLR4 antibody

FNab09837 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:8000
  • IHC: 1:50-1:500
  • Immunogen: toll-like receptor 4
  • Uniprot ID: O00206
  • Gene ID: 7099
  • Research Area: Neuroscience, Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against TLR4

Anti-TLR4 Antibody

PA1484 100ug/vial
EUR 334

Recombinant human TLR4

P2006 100ug Ask for price
  • Uniprot ID: O00206
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human TLR4

Anti-TLR4 antibody

PAab08727 100 ug
EUR 355

pcDNA3-TLR4-YFP

PVT14486 2 ug
EUR 599

Anti-TLR4 antibody

STJ110884 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-TLR4 antibody

STJ25867 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-TLR4 antibody

STJ113740 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-TLR4 antibody

STJ119553 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-TLR4 antibody

STJ16100496 1 mL
EUR 604

Anti-TLR4 antibody

STJ16100497 0.5 ml
EUR 478

Anti-TLR4 antibody

STJ29910 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-TLR4 antibody

STJ97404 200 µl
EUR 197
Description: Rabbit polyclonal to TLR4.

Anti-TLR4 Antibody

STJ503278 100 µg
EUR 476

Anti-TLR4 (3B6)

YF-MA10943 100 ug
EUR 363
Description: Mouse monoclonal to TLR4

Anti-TLR4 (1H7)

YF-MA10944 100 ug
EUR 363
Description: Mouse monoclonal to TLR4

Anti-TLR4 (1H7)

YF-MA15891 200 ul
EUR 363
Description: Mouse monoclonal to TLR4

Anti-TLR4 (4B10)

YF-MA15894 100 ug
EUR 363
Description: Mouse monoclonal to TLR4

Anti-TLR4 (3G12)

YF-MA15895 100 ug
EUR 363
Description: Mouse monoclonal to TLR4

TAK-242 dose dependency inhibit the expression of an increase in IL-6, IL-8, MMP-1 and VEGF in LPS-stimulated cells MH7A.

October 2021
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031

Categories

Recent Posts

Tags