Toll-like receptors (TLRs)

Toll-like receptors (TLRs) are a class of proteins

fallback-image

Arl13B Goat Polyclonal

Lab Reagents

Goat Polyclonal Laboratories manufactures the arl13b goat polyclonal reagents distributed by Genprice. The Arl13B Goat Polyclonal reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact goat polyclonal. Other Arl13B products are available in stock. Specificity: Arl13B Category: Goat Group: Polyclonal

Polyclonal information

ARL13B siRNA

20-abx908104
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARL13B Blocking Peptide

33R-8244 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARL13B antibody, catalog no. 70R-3969

ARL13B Blocking Peptide

33R-9507 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARL13B antibody, catalog no. 70R-4152

ARL13B Blocking Peptide

DF12000-BP 1mg
EUR 195

ARL13B cloning plasmid

CSB-CL659639HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1287
  • Sequence: ATGTTCAGTCTGATGGCCAGTTGCTGCGGCTGGTTCAAGCGGTGGCGGGAGCCTGTCAGAAAGGTGACTCTTTTGATGGTGGGACTTGATAATGCTGGTAAAACCGCAACAGCAAAGGGAATCCAAGGAGAATACCCTGAAGATGTAGCTCCTACTGTTGGATTTTCAAAAATTA
  • Show more
Description: A cloning plasmid for the ARL13B gene.

ARL13B Rabbit pAb

A5200-100ul 100 ul
EUR 308

ARL13B Rabbit pAb

A5200-200ul 200 ul
EUR 459

ARL13B Rabbit pAb

A5200-20ul 20 ul
EUR 183

ARL13B Rabbit pAb

A5200-50ul 50 ul
EUR 223

anti- ARL13B antibody

FNab00572 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:50-1:500
  • IF: 1:50-1:200
  • Immunogen: ADP-ribosylation factor-like 13B
  • Uniprot ID: Q3SXY8
  • Gene ID: 200894
  • Research Area: Signal Transduction
Description: Antibody raised against ARL13B

Anti-ARL13B antibody

PAab00572 100 ug
EUR 355

Recombinant Human ARL13B

P0506 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: Q3SXY8
Description: Recombinant Human protein for ARL13B

Anti-ARL13B antibody

STJ27176 100 µl
EUR 277
Description: This gene encodes a member of the ADP-ribosylation factor-like family. The encoded protein is a small GTPase that contains both N-terminal and C-terminal guanine nucleotide-binding motifs. This protein is localized in the cilia and plays a role in cilia formation and in maintenance of cilia. Mutations in this gene are the cause of Joubert syndrome 8. Alternate splicing results in multiple transcript variants.

Anti-ARL13B (7G9)

YF-MA20623 200 ul
EUR 363
Description: Mouse monoclonal to ARL13B

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

DLR-GOAT-Hu-48T 48T
EUR 554
  • Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

DLR-GOAT-Hu-96T 96T
EUR 725
  • Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RDR-GOAT-Hu-48Tests 48 Tests
EUR 589
October 2021
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031

Categories

Recent Posts

Tags