Decreased Toll-like Receptor (TLR) 2 and 4 Expression in Spermatozoa in Couples with Unexplained Recurrent Spontaneous Abortion (URSA).

Decreased Toll-like Receptor (TLR) 2 and 4 Expression in Spermatozoa in Couples with Unexplained Recurrent Spontaneous Abortion (URSA).

Studies have shown that pulses like receptor (TLR) play several important roles in the process of reproduction such as ovulation, spermatogenesis, capacitation of sperm, fertilization, and pregnancy to the best of our knowledge, no study has evaluated the expression and role of these molecules and their decline in spermatozoa; accompanied with pregnancy complications such as recurrent spontaneous abortion (RSA). Therefore, this study investigated the changes in pulse like receptor 2 (TLR2) and pulses like receptor 4 (TLR4) expression in spermatozoa in men whose partner has described RSA.

Fifteen infertile couples and described fifteen couples with recurrent spontaneous abortion (URSA) were included in this study. TLR2 and TLR4 expression levels of untreated and lipopolysaccharide (LPS) or PAM3CYS in spermatozoa treated examined by flow cytometry. The results showed reduced expression of TLR4 in spermatozoa untreated and decreased levels of LPS or PAM3CYS in spermatozoa treated in URSA group compared with the control group. No significant differences were found in TLR2 expression untreated spermatozoa in the RSA and the control group. After treatment of spermatozoa with LPS, TLR2 expression was decreased in both groups.

After treatment of spermatozoa with PAM3CYS, TLR2 expression levels increased significantly in URSA group; while no significant differences were shown in the control group compared to the untreated spermatozoa. We have concluded that the decrease in the expression of TLR4 and TLR2 differ increased expression in response to ligands on the treatment of spermatozoa associated with Ursa.

Decreased Toll-like Receptor (TLR) 2 and 4 Expression in Spermatozoa in Couples with Unexplained Recurrent Spontaneous Abortion (URSA).
Decreased Toll-like Receptor (TLR) 2 and 4 Expression in Spermatozoa in Couples with Unexplained Recurrent Spontaneous Abortion (URSA).

Toll-like receptor (TLR) responds tributyltin chloride (TBT-Cl) of exposure at river puffer (Takifugu obscurus): Evidence for toxic injury function.

Tributyltin chloride (TBT-Cl) in the rest of the body of water has become a real problem for the aquatic ecosystem ecology. Toll-like receptor (TLR) is an ancient family of pattern recognition receptors that play a key role in detecting non-self antigens and activation of the immune system. In this study, we explored the effect of exposure to TBT-Cl in four expression of TLRs in the river puffer, Takifugu obscurus.

Fourth T. obscurus Toll-like receptor (To-TLRs) contained various types of domains like leucine-rich repeats (LRRs), leucine rich repeats, typical of the subfamily (LRR_TYP) and other specialized domains. To-TLRs mRNA transcripts expressed in all tissues, as well as To-TLR2 investigated with higher levels in the kidney, as well as To-TLR3 in the kidneys, while the To-TLR18 in the liver and To-TLR22 in the intestine. After the acute and chronic exposure of TBT-Cl, To-To-TLR2 and TLR3 mRNA transcripts were significantly down-regulated in the gills. However, To-To-TLR22 TLR18 and significantly up-regulated in the gills and liver.

In addition, histology and immunohistochemistry (IHC) results showed different degrees of injury of TBT-Cl in the liver and gills and implied the reorganization of the cytoplasm after the stress of TBT-Cl and immunoregulation function to the To-TLRs exposure to TBT-Cl. All results indicate that the To-TLRs might be involved in sensing and mediating innate immune response caused by TBT-Cl to maintain homeostasis detoxification.


BACKGROUND Myasthenia gravis (MG) is a progressive autoimmune disorder caused by the production of antibodies directed against acetylcholine receptors (AChRs), resulting in muscle weakness and fatigue. This study aimed to explore the effects and mechanism of grilled nux vomica (GNV) in experimental autoimmune myasthenia gravis (EAMG) mice.

Human Toll Like Receptor 1 (TLR1) ELISA Kit

RDR-TLR1-Hu-48Tests 48 Tests
EUR 522

Human Toll Like Receptor 1 (TLR1) ELISA Kit

RDR-TLR1-Hu-96Tests 96 Tests
EUR 724

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

RDR-TLR1-Mu-48Tests 48 Tests
EUR 534

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

RDR-TLR1-Mu-96Tests 96 Tests
EUR 742

Human Toll Like Receptor 1 (TLR1) ELISA Kit

RD-TLR1-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 1 (TLR1) ELISA Kit

RD-TLR1-Hu-96Tests 96 Tests
EUR 692

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

RD-TLR1-Mu-48Tests 48 Tests
EUR 511

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

RD-TLR1-Mu-96Tests 96 Tests
EUR 709

TLR1

HY-W011400 500ug
EUR 165

TLR1 Antibody

24361-100ul 100ul
EUR 390

TLR1 Antibody

24362-100ul 100ul
EUR 390

TLR1 antibody

20R-1578 100 ul
EUR 673
Description: Goat polyclonal TLR1 antibody

TLR1 antibody

70R-11831 100 ul
EUR 447
Description: Goat polyclonal TLR1 antibody

TLR1 Antibody

3446-100
EUR 338

TLR1 Antibody

32117-100ul 100ul
EUR 252

TLR1 Antibody

1-CSB-PA080182
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

TLR1 Antibody

1-CSB-PA953581
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

TLR1 Antibody

DF6179 200ul
EUR 304
Description: TLR1 Antibody detects endogenous levels of total TLR1.

TLR1 Antibody

CSB-PA023599KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR1 Antibody

CSB-PA023599KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR1 Antibody

1-CSB-PA023599LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TLR1 siRNA

20-abx936889
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR1 siRNA

20-abx936890
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR1 Antibody

ABD6179 100 ug
EUR 438

anti-TLR1

YF-PA24854 50 ul
EUR 334
Description: Mouse polyclonal to TLR1

TLR1 Rabbit pAb

A0997-100ul 100 ul
EUR 308

TLR1 Rabbit pAb

A0997-200ul 200 ul
EUR 459

TLR1 Rabbit pAb

A0997-20ul 20 ul
EUR 183

TLR1 Rabbit pAb

A0997-50ul 50 ul
EUR 223

Polyclonal TLR1 Antibody

APG00001G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TLR1 . This antibody is tested and proven to work in the following applications:

TLR1 Blocking Peptide

DF6179-BP 1mg
EUR 195

Anti-TLR1 Antibody

A00429-2 100ug/vial
EUR 334

Anti-TLR1 Antibody

A00429-3 100ug/vial
EUR 334

TLR1 Polyclonal Antibody

EA183-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR1 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody

EA183-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR1 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TLR1 Conjugated Antibody

C32117 100ul
EUR 397

Polyclonal TLR1 Antibody

APR06374G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 . This antibody is tested and proven to work in the following applications:

Polyclonal TLR1 Antibody

APR06375G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 . This antibody is tested and proven to work in the following applications:

TLR1 cloning plasmid

CSB-CL023599HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2361
  • Sequence: ATGACTAGCATCTTCCATTTTGCCATTATCTTCATGTTAATACTTCAGATCAGAATACAATTATCTGAAGAAAGTGAATTTTTAGTTGATAGGTCAAAAAACGGTCTCATCCACGTTCCTAAAGACCTATCCCAGAAAACAACAATCTTAAATATATCGCAAAATTATATATCTG
  • Show more
Description: A cloning plasmid for the TLR1 gene.

TLR1 Polyclonal Antibody

ABP57211-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody

ABP57211-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody

ABP57211-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody

ABP57213-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody

ABP57213-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody

ABP57213-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody

ES8210-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody

ES8210-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody

ES8212-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody

ES8212-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

Anti-TLR1 Antibody

PA2246 100ug/vial
EUR 294

Anti-TLR1 antibody

STJ25862 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene.

Anti-TLR1 antibody

STJ97405 200 µl
EUR 197
Description: Rabbit polyclonal to TLR1.

Anti-TLR1 antibody

STJ97407 200 µl
EUR 197
Description: Rabbit polyclonal to TLR1.

Anti-TLR1 Antibody

STJ503274 100 µg
EUR 476

Anti-TLR1 Antibody

STJ503276 100 µg
EUR 476

Polyclonal TLR1 Antibody (Internal)

APR02386G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (Internal). This antibody is tested and proven to work in the following applications:

Mouse TLR1 shRNA Plasmid

20-abx973135
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TLR1 Antibody, HRP conjugated

1-CSB-PA023599LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TLR1 Antibody, FITC conjugated

1-CSB-PA023599LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TLR1 Antibody, Biotin conjugated

1-CSB-PA023599LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human TLR1 shRNA Plasmid

20-abx954863
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TLR1 Recombinant Protein (Rat)

RP233252 100 ug Ask for price

pCMV-Flag-TLR1 Plasmid

PVTB00372-2a 2 ug
EUR 356

pEYFP-N1-TLR1 Plasmid

PVTB00372-2b 2 ug
EUR 356

TLR1 Recombinant Protein (Human)

RP044170 100 ug Ask for price

TLR1 Recombinant Protein (Mouse)

RP178949 100 ug Ask for price

Anti-TLR1 Antibody BIOTIN

STJ503283 100 µg
EUR 586

Anti-TLR1 Antibody FITC

STJ503284 100 µg
EUR 586

Anti-TLR1 Antibody (Biotin)

STJ503285 100 µg
EUR 586

Anti-TLR1 Antibody (FITC)

STJ503286 100 µg
EUR 586

Polyclonal TLR1 Antibody (N-Terminus)

APR02280G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TLR1 Antibody (aa400-450)

APR02824G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (aa400-450). This antibody is tested and proven to work in the following applications:

Human Toll-like receptor (TLR1)

1-CSB-YP023599HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Toll-like receptor(TLR1),partial expressed in Yeast

ELISA kit for Human TLR1

EK5487 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human TLR1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TLR1 PicoKine ELISA Kit

EK1129 96 wells
EUR 425
Description: For quantitative detection of human TLR1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

CD281/TLR1 ELISA KIT|Human

EF007394 96 Tests
EUR 689

Tlr1 ORF Vector (Rat) (pORF)

ORF077752 1.0 ug DNA
EUR 506

h TLR1 inducible lentiviral particles

LVP743 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h TLR1 (toll-like receptor 1), [alternative names: CD281; rsc786; TIL; TIL. LPRS5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_003263. It also contains a RFP-Blasticidin dual selection marker.

TLR1 ORF Vector (Human) (pORF)

ORF014724 1.0 ug DNA
EUR 354

Tlr1 ORF Vector (Mouse) (pORF)

ORF059651 1.0 ug DNA
EUR 506

pECMV-Tlr1-m-FLAG Plasmid

PVT15247 2 ug
EUR 325

TLR1 ELISA Kit (Human) (OKAN05048)

OKAN05048 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.114 ng/mL

TLR1 ELISA Kit (Human) (OKBB00505)

OKBB00505 96 Wells
EUR 505
Description: Description of target: TLR1 is a member of the Toll-like receptor family (TLR) of pattern recognition receptors of the innate immune system. TIR1 gene was mapped to 4p14 by fluorescence in situ hybridization. TLR1 recognizes pathogen-associated molecular pattern with a specificity for gram-positive bacteria. TLR1 has also been designated as CD281 (cluster of differentiation 281). TLR1 interacts with TLR2 to recognize the lipid configuration of the native mycobacterial lipoprotein as well as several triacylated lipopeptides.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

TLR1 ELISA Kit (Human) (OKCD07880)

OKCD07880 96 Wells
EUR 936
Description: Description of target: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.127ng/mL

TLR1 ELISA Kit (Mouse) (OKCD07881)

OKCD07881 96 Wells
EUR 818
Description: Description of target: Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.108ng/mL

Toll Like Receptor 1 (TLR1) Antibody

20-abx178627
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Toll Like Receptor 1 (TLR1) Antibody

20-abx211714
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody

20-abx102056
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 1 (TLR1) Antibody

20-abx102057
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 1 (TLR1) Antibody

abx117022-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody

20-abx130820
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 1 (TLR1) Antibody

20-abx131782
  • EUR 425.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 154.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 1 (TLR1) Antibody

abx145022-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody

20-abx174837
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Toll Like Receptor 1 (TLR1) Antibody

20-abx270116
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody

20-abx326826
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody

20-abx313153
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody

20-abx000950
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tlr1 sgRNA CRISPR Lentivector set (Rat)

K6213301 3 x 1.0 ug
EUR 339

Tlr1 sgRNA CRISPR Lentivector set (Mouse)

K4373201 3 x 1.0 ug
EUR 339

TLR1 sgRNA CRISPR Lentivector set (Human)

K2379701 3 x 1.0 ug
EUR 339

Recombinant Toll Like Receptor 1 (TLR1)

4-RPB988Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15399
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Toll Like Receptor 1 expressed in: E.coli

Recombinant Toll Like Receptor 1 (TLR1)

4-RPB988Hu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15399
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Toll Like Receptor 1 expressed in: E.coli

Recombinant Toll Like Receptor 1 (TLR1)

4-RPB988Mu01
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9EPQ1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Toll Like Receptor 1 expressed in: E.coli

Mouse Toll Like Receptor 1 (TLR1) Protein

20-abx168804
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Toll Like Receptor 1 (TLR1) Protein

20-abx069356
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Toll Like Receptor 1 (TLR1) Protein

20-abx069357
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (FITC)

20-abx270414
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (APC)

20-abx270646
  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (PE)

20-abx270878
  • EUR 606.00
  • EUR 718.00
  • EUR 328.00
  • EUR 1135.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (Biotin)

20-abx272228
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody Pair

20-abx370377
  • EUR 1664.00
  • EUR 1066.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (FITC)

20-abx273662
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll-Like Receptor 1 (TLR1) Antibody (HRP)

20-abx313154
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody (FITC)

20-abx313155
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody (Biotin)

20-abx313156
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6213302 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6213303 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6213304 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4373202 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4373203 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4373204 1.0 ug DNA
EUR 154

TLR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2379702 1.0 ug DNA
EUR 154

TLR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2379703 1.0 ug DNA
EUR 154

TLR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2379704 1.0 ug DNA
EUR 154

TLR1 Protein Vector (Rat) (pPB-C-His)

PV311006 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPB-N-His)

PV311007 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPM-C-HA)

PV311008 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPM-C-His)

PV311009 500 ng
EUR 1166

TLR1 Protein Vector (Human) (pPB-C-His)

PV058893 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPB-N-His)

PV058894 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPM-C-HA)

PV058895 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPM-C-His)

PV058896 500 ng
EUR 481

TLR1 Protein Vector (Mouse) (pPB-C-His)

PV238602 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPB-N-His)

PV238603 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPM-C-HA)

PV238604 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPM-C-His)

PV238605 500 ng
EUR 1065

Tlr1 3'UTR Luciferase Stable Cell Line

TU120542 1.0 ml Ask for price

Tlr1 3'UTR GFP Stable Cell Line

TU170542 1.0 ml Ask for price

Tlr1 3'UTR Luciferase Stable Cell Line

TU221934 1.0 ml Ask for price

TLR1 3'UTR GFP Stable Cell Line

TU075639 1.0 ml
EUR 1394

Tlr1 3'UTR GFP Stable Cell Line

TU271934 1.0 ml Ask for price

TLR1 3'UTR Luciferase Stable Cell Line

TU025639 1.0 ml
EUR 1394

TLR1 ELISA Kit (Mouse) : 96 Wells (OKEH01414)

OKEH01414 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.079 ng/mL

Human Toll-like receptor 1,TLR1 ELISA Kit

201-12-0364 96 tests
EUR 440
  • This Toll-like receptor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Anti-Human TLR1 DyLight® 488 conjugated Antibody

A00429-Dyl488 100ug/vial
EUR 344

Anti-Human TLR1 DyLight® 550 conjugated Antibody

A00429-Dyl550 100ug/vial
EUR 344

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

20-abx154783
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Toll Like Receptor 1 (TLR1) ELISA Kit

20-abx153340
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

abx255056-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Toll Like Receptor 1 (TLR1) ELISA Kit

abx257473-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Mouse Tlr1/ Toll-like receptor 1 ELISA Kit

E1479Mo 1 Kit
EUR 571

Mouse Toll- like receptor 1, Tlr1 ELISA KIT

ELI-06395m 96 Tests
EUR 865

Human Toll- like receptor 1, TLR1 ELISA KIT

ELI-06396h 96 Tests
EUR 824

Human Toll Like Receptor 1 (TLR1) ELISA Kit

abx358465-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Toll Like Receptor 1 (TLR1) ELISA Kit

abx570435-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

abx573132-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Toll Like Receptor 1 (TLR1) CLIA Kit

20-abx493338
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Toll Like Receptor 1 (TLR1) CLIA Kit

20-abx493339
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse TLR1(Toll-like receptor 1) ELISA Kit

EM0708 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9EPQ1
  • Alias: TLR1/CD281/CD281/CD281 antigen/DKFZp547I0610/DKFZp564I0682/KIAA0012MGC126311/MGC104956/MGC126312/rsc786/TIL/TIL. LPRS5/Toll/interleukin-1 receptor-like protein/toll-like receptor 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Human Toll-like receptor 1(TLR1)ELISA Kit

GA-E0380HM-48T 48T
EUR 289

Human Toll-like receptor 1(TLR1)ELISA Kit

GA-E0380HM-96T 96T
EUR 466

TLR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV654433 1.0 ug DNA
EUR 1355

TLR1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV654437 1.0 ug DNA
EUR 1355

TLR1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV654438 1.0 ug DNA
EUR 1355

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human)

4-PAB988Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1)

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human)

4-PAB988Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1)

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse)

4-PAB988Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1)

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human)

4-MAB988Hu21
  • EUR 310.00
  • EUR 3500.00
  • EUR 850.00
  • EUR 400.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1)

Human Toll-like receptor 1(TLR1)ELISA Kit

QY-E04535 96T
EUR 361

Human Toll Like Receptor 1 ELISA Kit (TLR1)

RK02395 96 Tests
EUR 521

Human Toll Like Receptor 1 (TLR1) ELISA Kit

SEB988Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Toll Like Receptor 1 (TLR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Toll Like Receptor 1 (TLR1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Toll Like Receptor 1 (TLR1) ELISA Kit

SEB988Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Toll Like Receptor 1 (TLR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Toll Like Receptor 1 (TLR1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Toll Like Receptor 1 (TLR1) ELISA Kit

SEB988Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Toll Like Receptor 1 (TLR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Toll Like Receptor 1 (TLR1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Toll Like Receptor 1 (TLR1) ELISA Kit

SEB988Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Toll Like Receptor 1 (TLR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Toll Like Receptor 1 (TLR1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Toll Like Receptor 1 (TLR1) ELISA Kit

4-SEB988Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Toll Like Receptor 1 elisa. Alternative names of the recognized antigen: CD281
  • TIL
  • Rsc786
  • Toll/interleukin-1 receptor-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Toll Like Receptor 1 (TLR1) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

SEB988Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Toll Like Receptor 1 (TLR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Toll Like Receptor 1 (TLR1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

SEB988Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Toll Like Receptor 1 (TLR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Toll Like Receptor 1 (TLR1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

SEB988Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Toll Like Receptor 1 (TLR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Toll Like Receptor 1 (TLR1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

SEB988Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Toll Like Receptor 1 (TLR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Toll Like Receptor 1 (TLR1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit

4-SEB988Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Toll Like Receptor 1 elisa. Alternative names of the recognized antigen: CD281
  • TIL
  • Rsc786
  • Toll/interleukin-1 receptor-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Toll Like Receptor 1 (TLR1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

MATERIALS AND METHODS Mice 97-116 peptides used to mediate the disease in the model EAMG in SPF female Lewis rats. The treatment group received grilled Nux Vomica (75 mg / kg, 150 mg / kg, and 225 mg / kg). The autoantibodies and inflammatory cytokine levels were measured by enzyme-linked immunosorbent assay (ELISA). RNA profiles done on the high dose group and rat models.

Sierra

Related Posts

Key Player in Cardiac Hypertrophy, Emphasizing the Role of Toll-Like Receptor 4

Key Player in Cardiac Hypertrophy, Emphasizing the Role of Toll-Like Receptor 4

Betaine inhibits Toll-like receptor 4 responses and restores intestinal microbiota in acute liver failure mice

Betaine inhibits Toll-like receptor 4 responses and restores intestinal microbiota in acute liver failure mice

Muscle-specific Deletion of Toll-like Receptor 4 Impairs Metabolic Adaptation to Wheel Running in Mice

Muscle-specific Deletion of Toll-like Receptor 4 Impairs Metabolic Adaptation to Wheel Running in Mice

Toll-Like Receptor Agonists as Adjuvants for Allergen Immunotherapy

Toll-Like Receptor Agonists as Adjuvants for Allergen Immunotherapy

No Comment

Leave a Reply

Your email address will not be published. Required fields are marked *

October 2021
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031

Categories

Recent Posts

Tags