Lab Reagents

Human IgG antibody Laboratories manufactures the synj2bp rabbit polyclonal antibody proteintech reagents distributed by Genprice. The Synj2Bp Rabbit Polyclonal Antibody Proteintech reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact rabbit Antibody. Other Synj2Bp products are available in stock. Specificity: Synj2Bp Category: Rabbit Group: Polyclonal Antibody

Polyclonal Antibody information

SYNJ2BP Antibody
1-CSB-PA023018LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

Polyclonal SYNJ2BP Antibody (N-Term)
AMM08070G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYNJ2BP (N-Term). This antibody is tested and proven to work in the following applications:

SYNJ2BP Polyclonal Antibody, HRP Conjugated
A63533	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

SYNJ2BP Polyclonal Antibody, FITC Conjugated
A63534	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SYNJ2BP Polyclonal Antibody, Biotin Conjugated
A63535	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Synj2bp/ Rat Synj2bp ELISA Kit
ELI-46230r	Lifescience Market	96 Tests	EUR 886

Human SYNJ2BP Antibody
32068-05111	AssayPro	150 ug	EUR 261

anti- SYNJ2BP antibody
FNab08439	FN Test	100µg	EUR 548.75
Immunogen: synaptojanin 2 binding protein Uniprot ID: P57105 Gene ID: 55333 Research Area: Signal Transduction
Description: Antibody raised against SYNJ2BP

Anti-SYNJ2BP antibody
PAab08439	Lifescience Market	100 ug	EUR 386

Anti-SYNJ2BP antibody
STJ117664	St John's Laboratory	100 µl	EUR 277

SYNJ2BP siRNA
20-abx905404	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYNJ2BP siRNA
20-abx935814	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYNJ2BP siRNA
20-abx935815	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYNJ2BP Antibody, HRP conjugated
1-CSB-PA023018LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SYNJ2BP Antibody, FITC conjugated
1-CSB-PA023018LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SYNJ2BP Antibody, Biotin conjugated
1-CSB-PA023018LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SYNJ2BP cloning plasmid
CSB-CL023018HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 438 Sequence: atgaacggaagagtggattatttggtcactgaggaagagatcaatcttaccagagggccctcagggctgggcttcaacatcgtcggtgggacagatcagcagtatgtctccaacgacagtggcatctacgtcagccgcatcaaagaaaatggggctgcggccctggatgggcggct Show more
Description: A cloning plasmid for the SYNJ2BP gene.