Toll-like receptors (TLRs)

Toll-like receptors (TLRs) are a class of proteins


Synj2Bp Rabbit Polyclonal Antibody Proteintech

Lab Reagents

Human IgG antibody Laboratories manufactures the synj2bp rabbit polyclonal antibody proteintech reagents distributed by Genprice. The Synj2Bp Rabbit Polyclonal Antibody Proteintech reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact rabbit Antibody. Other Synj2Bp products are available in stock. Specificity: Synj2Bp Category: Rabbit Group: Polyclonal Antibody

Polyclonal Antibody information

SYNJ2BP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

Polyclonal SYNJ2BP Antibody (N-Term)

AMM08070G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYNJ2BP (N-Term). This antibody is tested and proven to work in the following applications:

SYNJ2BP Polyclonal Antibody, HRP Conjugated

A63533 100 µg
EUR 570.55
Description: Ask the seller for details

SYNJ2BP Polyclonal Antibody, FITC Conjugated

A63534 100 µg
EUR 570.55
Description: The best epigenetics products

SYNJ2BP Polyclonal Antibody, Biotin Conjugated

A63535 100 µg
EUR 570.55
Description: kits suitable for this type of research

Synj2bp/ Rat Synj2bp ELISA Kit

ELI-46230r 96 Tests
EUR 886

Human SYNJ2BP Antibody

32068-05111 150 ug
EUR 261

anti- SYNJ2BP antibody

FNab08439 100µg
EUR 548.75
  • Immunogen: synaptojanin 2 binding protein
  • Uniprot ID: P57105
  • Gene ID: 55333
  • Research Area: Signal Transduction
Description: Antibody raised against SYNJ2BP

Anti-SYNJ2BP antibody

PAab08439 100 ug
EUR 386

Anti-SYNJ2BP antibody

STJ117664 100 µl
EUR 277


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYNJ2BP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SYNJ2BP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SYNJ2BP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SYNJ2BP cloning plasmid

CSB-CL023018HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 438
  • Sequence: atgaacggaagagtggattatttggtcactgaggaagagatcaatcttaccagagggccctcagggctgggcttcaacatcgtcggtgggacagatcagcagtatgtctccaacgacagtggcatctacgtcagccgcatcaaagaaaatggggctgcggccctggatgggcggct
  • Show more
Description: A cloning plasmid for the SYNJ2BP gene.
October 2021


Recent Posts
